90
|
Kaneka Corp
p7 8bp primer plate (384  P7 8bp Primer Plate (384, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/p7 8bp primer plate (384/product/Kaneka Corp Average 90 stars, based on 1 article reviews
p7 8bp primer plate (384 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat Plate Adapters P5: Aatgatacggcgaccaccgagatctacac P7: Caagcagaagacggcatacgagat, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat/product/Illumina Inc Average 90 stars, based on 1 article reviews
plate adapters p5: aatgatacggcgaccaccgagatctacac p7: caagcagaagacggcatacgagat - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Schmizo AG
suction plates ø borosilicate glass pore size p5 Suction Plates ø Borosilicate Glass Pore Size P5, supplied by Schmizo AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/suction plates ø borosilicate glass pore size p5/product/Schmizo AG Average 90 stars, based on 1 article reviews
suction plates ø borosilicate glass pore size p5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Miles Scientific
silica g plates 250-p 5 x Silica G Plates 250 P 5 X, supplied by Miles Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/silica g plates 250-p 5 x/product/Miles Scientific Average 90 stars, based on 1 article reviews
silica g plates 250-p 5 x - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Stable Micro Systems Ltd
plate probe p/5 Plate Probe P/5, supplied by Stable Micro Systems Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plate probe p/5/product/Stable Micro Systems Ltd Average 90 stars, based on 1 article reviews
plate probe p/5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Chronological and genetic analysis of an Upper Palaeolithic female infant burial from Borsuka Cave, Poland
doi: 10.1016/j.isci.2023.108283
Figure Lengend Snippet:
Article Snippet:
Techniques: Recombinant, Magnetic Beads, Hybridization, Blocking Assay, SYBR Green Assay, Purification, Software, Ancient DNA Assay